CRISPR-GATE: a one-stop repository and guide to computational resources for genome editing experimentation

CRISPR-Cas gene editing tools have revolutionized the field of biotechnology.Originally part of a bacterial immune system, Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) and their associated proteins (Cas) can cleave specific DNA sequences that match the RNA sequence coded into the Cas protein.CRISPR has great potential for curing genetic diseases and cancers.However, many challenges must be overcome, including the risk of off-target cuts and their resulting consequences, on-target effects, adverse immune system reactions, the need for a double-stranded DNA break (DSB), and the need for a donor template to carry out homology-directed repair.Alternatively, base editing and prime editing are technologies that can edit genes without a DSB and donor template.There is also a reduced risk of off-target editing, which mitigates a significant safety concern.A key application of CRISPR and other gene editing technologies is curing monogenic diseases, which arise from mutations in a single gene.This makes them simpler to treat than other types of genetic diseases.Here, we present the principles of CRISPR, base editing, and prime editing, and discuss how they can be applied in a clinical setting to treat or cure monogenic diseases.

CRISPR (clustered regularly interspaced short palindromic repeats) systems are one of the most fascinating tools of the current era in molecular biotechnology. With the ease that they provide in genome editing, CRISPR systems generate broad opportunities for targeting mutations. Specifically in recent years, disease-causing mutations targeted by the CRISPR systems have been of main research interest; particularly for those diseases where there is no current cure, including cancer. KRAS mutations remain untargetable in cancer. Mutations in this oncogene are main drivers in common cancers, including lung, colorectal and pancreatic cancers, which are severe causes of public health burden and mortality worldwide, with no cure at hand. CRISPR systems provide an opportunity for targeting cancer causing mutations. In this review, we highlight the work published on CRISPR applications targeting KRAS mutations directly, as well as CRISPR applications targeting mutations in KRAS-related molecules. In specific, we focus on lung, colorectal and pancreatic cancers. To date, the limited literature on CRISPR applications targeting KRAS, reflect promising results. Namely, direct targeting of mutant KRAS variants using various CRISPR systems resulted in significant decrease in cell viability and proliferation in vitro, as well as tumor growth inhibition in vivo. In addition, the effect of mutant KRAS knockdown, via CRISPR, has been observed to exert regulatory effects on the downstream molecules including PI3K, ERK, Akt, Stat3, and c-myc. Molecules in the KRAS pathway have been subjected to CRISPR applications more often than KRAS itself. The aim of using CRISPR systems in these studies was mainly to analyze the therapeutic potential of possible downstream and upstream effectors of KRAS, as well as to discover further potential molecules. Although there have been molecules identified to have such potential in treatment of KRAS-driven cancers, a substantial amount of effort is still needed to establish treatment strategies based on these discoveries. We conclude that, at this point in time, despite being such a powerful directed genome editing tool, CRISPR remains to be underutilized for targeting KRAS mutations in cancer. Efforts channelled in this direction, might pave the way in solving the long-standing challenge of targeting the KRAS mutations in cancers.

The advent of clustered regularly interspaced short palindromic repeats (CRISPR) technology has revolutionized the field of genetic engineering and molecular biology, offering unprecedented opportunities for precise genome editing. Initially discovered as a natural defense mechanism in bacteria, CRISPR-Cas9 technology enables targeted modifications of DNA, paving the way for significant advancements in gene therapy. This review article explores the multifaceted applications of CRISPR, focusing on its transformative potential in treating genetic diseases and various forms of cancer. We delve into the mechanisms by which CRISPR operates, emphasizing its dual-step process of targeting and cutting DNA, and highlighting its versatility in investigating gene functions and developing therapeutic strategies. Specific applications in genetic disorders, including sickle cell disease and cystic fibrosis, showcase the promising outcomes of ongoing pre-clinical and clinical trials. In the realm of oncology, CRISPR’s ability to edit oncogenes and enhance immune cell functions exemplifies its role in developing personalized cancer therapies. However, the rapid advancement of CRISPR technology also necessitates critical discussions around ethical considerations and regulatory challenges, particularly concerning off-target effects and the implications of germline editing. Looking ahead, innovations such as CRISPR 2.0, base editing, and prime editing are set to further expand the therapeutic landscape, enhancing the precision and safety of gene editing. This article underscores the importance of collaborative efforts across scientific, ethical, and regulatory domains to navigate the complexities of CRISPR technology while maximizing its benefits for patients and society.

The potential to therapeutically alter the genome is one of the remarkable scientific developments in recent years. Genome editing technologies have provided an opportunity to precisely alter genomic sequence(s) in eukaryotic cells as a treatment option for various genetic disorders. These technologies allow the correction of harmful mutations in patients by precise nucleotide editing. Genome editing technologies such as CRISPR (clustered regularly interspaced short palindromic repeat) and base editors have greatly contributed to the practical applications of gene editing. However, these technologies have certain limitations, including imperfect editing, undesirable mutations, off-target effects, and lack of potential to simultaneously edit multiple loci. Recently, prime editing (PE) has emerged as a new gene editing technology with the potential to overcome the above-mentioned limitations. Interestingly, PE not only has higher specificity but also does not require double-strand breaks. In addition, a minimum possibility of potential off-target mutant sites makes PE a preferred choice for therapeutic gene editing. Furthermore, PE has the potential to introduce insertion and deletions of all 12 single-base mutations at target sequences. Considering its potential, PE has been applied as a treatment option for genetic diseases including hemoglobinopathies. β-Thalassemia, for example, one of the most significant blood disorders characterized by reduced levels of functional hemoglobin, could potentially be treated using PE. Therapeutic reactivation of the γ-globin gene in adult β-thalassemia patients through PE technology is considered a promising therapeutic strategy. The current review aims to briefly discuss the genome editing strategies and potential applications of PE for the treatment of β-thalassemia. In addition, the review will also focus on challenges associated with the use of PE.

β-Thalassemia is a prevalent inherited disorder of β-globin chains. The clustered regularly interspaced short palindromic repeats (CRISPR) genome editing system has emerged as a potential curative strategy. We conducted a bibliometric analysis to map global research trends in CRISPR-based thalassemia research. Original and review research articles were retrieved from the Scopus database using the search terms [TITLE-ABS-KEY (‘βeta thalassemia’ OR ‘β thalassemia’ OR thalassemia*) AND TITLE-ABS-KEY (‘gene edit*’ OR crispr* OR ‘clustered regularly interspaced short palindromic repeats’)] AND [LIMIT-TO (DOCTYPE, ‘re’) OR LIMIT-TO (DOCTYPE, ‘ar’)] for analysis. Bibliometric mapping and network visualization were performed using VOSviewer to analyze publication trends, authorship networks, international collaborations, keyword clusters, and citation metrics. Major CRISPR-based therapeutic strategies for thalassemia were reviewed to place experimental and clinical developments within a translational framework. The analysis demonstrates a clear transition from foundational genomic studies to translational applications, with leading contributions from the United States and China. Two dominant therapeutic strategies have emerged: direct correction of the HBB gene in hematopoietic stem cells and fetal hemoglobin reactivation via BCL11A repression. The latter strategy culminated in regulatory approval of exagamglogene autotemcel (Casgevy). Advances in base editing, prime editing, and strategies to improve engraftment are expected to enhance the precision and long-term efficacy of next-generation approaches. Clustered regularly interspaced short palindromic repeats-based research on thalassemia continues to expand, supported by extensive international collaboration and growing clinical translation. Future large-scale implementation will require advances in bioprocess engineering, cost reduction for ex vivo manufacturing, and adaptable treatment models for diverse healthcare systems.

The clustered regularly interspaced short palindromic repeats (CRISPR) system has been adopted for a wide range of biological applications including genome editing. In some cases, dissection of genome functions requires allele-specific genome editing, but the use of CRISPR for this purpose has not been studied in detail. In this study, using the p16INK4a gene in HCT116 as a model locus, we investigated whether chromatin states, such as CpG methylation, or a single-nucleotide gap form in a target site can be exploited for allele-specific locus binding and genome editing by CRISPR in vivo. First, we showed that allele-specific locus binding and genome editing could be achieved by targeting allele-specific CpG-methylated regions, which was successful for one, but not all guide RNAs. In this regard, molecular basis underlying the success remains elusive at this stage. Next, we demonstrated that an allele-specific single-nucleotide gap form could be employed for allele-specific locus binding and genome editing by CRISPR, although it was important to avoid CRISPR tolerance of a single nucleotide mismatch brought about by mismatched base skipping. Our results provide information that might be useful for applications of CRISPR in studies of allele-specific functions in the genomes.

The clustered regularly interspaced short palindromic repeats (CRISPR) system is inarguably the most valuable gene editing tool ever discovered. Currently, three classes of CRISPR-based genome editing systems have been developed for gene editing, including CRISPR/CRISPR associate system (Cas) nucleases, base editors, and prime editors. Ever-evolving CRISPR technology plays an important role in medicine; however, the biggest obstacle to its use in clinical practice is the induction of off-target effects (OTEs) during targeted editing. Therefore, continuous improvement and optimization of the CRISPR system for reduction of OTEs is a major focus in the field of CRISPR research. This review aims to provide a comprehensive guide for optimization of the CRISPR-based genome editing system.

ABSTRACTGenetic mutations cause approximately 80% of rare human diseases, highlighting the urgent need for precise genome editing. Since clustered regularly interspaced short palindromic repeat (CRISPR)‐CRISPR‐associated 9 (Cas9) nucleases were first used for genome editing in 2012, genome editing technologies have rapidly advanced. Base editors, derived from the CRISPR‐Cas system, were developed to introduce specific point mutations without requiring DNA double‐strand breaks, and subsequently, prime editing (PE) technology was created to enable insertions, deletions, and all types of point mutations. The precision and versatility of PE make it a promising tool for clinical applications. However, PE has potential limitations, including low editing efficiency and limited capacity for large‐scale manipulation. To overcome these limitations, research has been continuously conducted to improve PE efficiency and expand its capabilities. Therefore, this review aims to highlight current efforts and future directions for developing and improving PE‐related tools.

Precision medicine for sodium channelopathy-related autism and epilepsy.

The Aim of this article is to review CRISPR-based drug delivery systems and their therapeutic applications in gene therapy, focusing on advancements, challenges, and future prospects. Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) technology has emerged as a transformative tool in gene therapy, enabling precise and efficient genome editing with unprecedented ease compared to earlier platforms such as zinc finger nucleases and TALENs. By leveraging the Cas nuclease system, CRISPR enables targeted modification of disease-causing genes, offering promising therapeutic interventions for genetic disorders, cancers, and infectious diseases. However, the clinical translation of CRISPR-based therapeutics critically depends on the development of safe, efficient, and tissue-specific delivery systems. Current strategies encompass viral vectors (e.g., adeno-associated viruses, lentiviruses) and non-viral carriers (e.g., lipid nanoparticles, polymeric systems, cell-penetrating peptides), each with unique advantages and limitations in terms of delivery efficiency, cargo capacity, immunogenicity, and off-target effects. Advances in nanotechnology and biomaterials have further enabled targeted and stimuli-responsive delivery, enhancing therapeutic precision while minimizing systemic toxicity. Furthermore, CRISPR-based modalities such as base editing, prime editing, and CRISPR interference/activation expand the therapeutic landscape beyond simple gene knockout or repair. Despite remarkable progress, challenges remain in optimizing delivery to specific tissues, controlling off-target activity, and addressing ethical and regulatory concerns. This review provides a comprehensive overview of CRISPR-based drug delivery systems, recent preclinical and clinical advancements, and future perspectives in gene therapy, emphasizing innovations that bridge the gap between experimental success and clinical application.

The autobiographical genre is a problem when it is considered inside the theatral genre. Because the dramatical author express himself through the mouth of fictional characters, the words of the characters could not be considered as the expression of the author himself. However, it seems that through the dialogues that can be heard, the situations, the characters and the places that are staged, some plays, especially since the 18th century, which represents a major step in self-expression, contains the signs of an autobiographical expression. Although the autobiographical genre as defined by P. Lejeune or G. Gusdorf does not exists in the theatre genre, we will study here how it nevertheless expresses itself, that is to say almost always in a hidden, implicit, ambiguous, diverted, but probable way. We will think of a method allowing the reader, but also the member of the audience, to identify and testify the presence of this autobiographical expression by emphazising some textual and scenic aspects. We will also work on connecting the autobiographical expression with the relationship that live the authors of the new work contained in our corpus with the audience. This relationship being fully opend up in emotion. Some feelings, coming with physical reactions felt by the reader/audience, are created by the recognition of the author's voice in a drama that mixes autobiographical and fiction. We will take an interest in the autobiographical expression of the dramatical author through the perspective of his particular relationship with the audience, relationship that contrasts with Brecht's principles, which have ruled the theatrical creation in the 20th century.

Our review has described principles and functional importance of CRISPR-Cas9 with emphasis on the recent advancements, such as CRISPR-Cpf1, base editing (BE), prime editing (PE), epigenome editing, tissue-specific (CRISPR-TSKO), and inducible genome editing and their potential applications in generating stress-tolerant plants. Improved agricultural practices and enhanced food crop production using innovative crop breeding technology is essential for increasing access to nutritious foods across the planet. The crop plants play a pivotal role in energy and nutrient supply to humans. The abiotic stress factors, such as drought, heat, and salinity cause a substantial yield loss in crop plants and threaten food security. The most sustainable and eco-friendly way to overcome these challenges are the breeding of crop cultivars with improved tolerance against abiotic stress factors. The conventional plant breeding methods have been highly successful in developing abiotic stress-tolerant crop varieties, but usually cumbersome and time-consuming. Alternatively, the CRISPR/Cas genome editing has emerged as a revolutionary tool for making efficient and precise genetic manipulations in plant genomes. Here, we provide a comprehensive review of the CRISPR/Cas genome editing (GE) technology with an emphasis on recent advances in the plant genome editing, including base editing (BE), prime editing (PE), epigenome editing, tissue-specific (CRISPR-TSKO), and inducible genome editing (CRISPR-IGE), which can be used for obtaining cultivars with enhanced tolerance to various abiotic stress factors. We also describe tissue culture-free, DNA-free GE technology, and some of the CRISPR-based tools that can be modified for their use in crop plants.

Clustered regularly interspaced short palindromic repeat (CRISPR)/CRISPRassociated (Cas) technology is an efficient means of creating targeted deletion or insertion variants (DIVs). Our lab has taken advantage of this to develop a genome engineering pipeline that remains efficient at scale, which puts saturation mutagenesis within reach. The pipeline involves inducing DIVs with CRISPR/ Cas9, amplifying the targeted regions via PCR, and subjecting the amplicons to high-throughput sequencing. A key component of this process is the ampliconDIVider software, which identifies and characterizes DIVs at the nucleotide level. The program recovers DIVs within user-defined regions, parses samples based on DNA barcodes, and uses the sam2pairwise program to rapidly visualize DIVs as pairwise alignments. We applied this approach in Danio rerio, and identified 678 unique DIV alleles induced by 114 CRISPR targets in 58 genes. Contrary to previous reports, we detected no evidence that the primary sequence of the CRISPR affected mutagenesis efficiency, other than that the rate was reduced by the addition of extra guanines to the 5’ end of the target. ampliconDIVider is flexible, and is not limited to the context of this pipeline, nor to DIVs induced specifically by CRISPRs. TGCCGTTTGTGA ... ATGGGCAGCTGGGCCGTGAGTTAGTGCCTGTGGACGAGGCTTTCATGAAGAGAGATGAAG ... AGCAGAAAGGTT ! Field Value CIGAR 27M6D27M Sequence ATGGGCAGCTGGGCCGTGAGTTAGTGCACGAGGCTTTCATGAAGAGAGATGAAG MD Tag MD:Z:27^CTGTGG27 sam2pairwise (https://github.com/mlafave/sam2pairwise) ATGGGCAGCTGGGCCGTGAGTTAGTGC------ACGAGGCTTTCATGAAGAGAGATGAAG ! ||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ! ATGGGCAGCTGGGCCGTGAGTTAGTGCCTGTGGACGAGGCTTTCATGAAGAGAGATGAAG ! ampliconDIVider (https://github.com/mlafave/ampliconDIVider) samtools view file.bam | sam2pairwise ! Amplicon target DNA M13 PIG-tail Barcode Adapter Adapter Summary • ampliconDIVider facilitates high-throughput detection of deletion and insertion variants in defined regions • sam2pairwise turns SAM entries into pairwise alignments • The CRISPR pipeline is an efficient, scalable means for targeted mutagenesis • CRISPR sequence had no effect on mutagenesis rate in zebrafish, except when additional bases were added Amplicon target DNA M13 PIG-tail Barcode Trim non-genomic DNA, store barcode (cutadapt) Remove untrustworthy fragments Amplicon target A Barcode 1 Amplicon target A Barcode 2 Amplicon target B Barcode 1 Align reads to amplicon index (novoalign) Segregate by target and sample Amplicon target A Barcode 1 Amplicon target A Barcode 2 Amplicon target B Barcode 1 Target A Target B Barcode 1

In the fields of medicine and bioscience, gene editing is increasingly recognized as a promising therapeutic approach for treating pathogenic variants in humans and other living organisms. With advancements in technology and knowledge, it is now understood that most genetic defects are caused by single-base pair variants. The ability to substitute genes using genome editing tools enables scientists and doctors to cure genetic diseases and disorders. Starting with CRISPR (clustered regularly interspaced short palindromic repeats)/Cas, the technology has evolved to become more efficient and safer, leading to the development of base and prime editors. Furthermore, various approaches are used to treat genetic disorders such as hemophilia, cystic fibrosis, and Duchenne muscular dystrophy. As previously mentioned, most genetic defects leading to specific diseases are caused by single-base pair variants, which can occur at many locations in corresponding gene, potentially causing the same disease. This means that, even when using the same genome editing tool, results in terms of editing efficiency or treatment effectiveness may differ. Therefore, different approaches may need to be applied to different types of diseases. Prevalently, due to the safety of adeno-associated virus (AAV) vectors in gene therapy, most clinical trials of gene therapy are based on AAV delivery methods. However, despite their safety and nonintegration into the host genome, their limitations, such as confined capacity, dosage-dependent viral toxicity, and immunogenicity, necessitate the development of new approaches to enhance treatment effects. This review provides the structure and function of each CRISPR-based gene editing tool and focuses on introducing new approaches in gene therapy associated with improving treatment efficiency.

Climate change, rising global food demand, and shrinking resources require transformative innovations in crop breeding. This review outlines recent advances in new breeding technologies (NBTs), including molecular markers, genome-wide association studies (GWAS), genomic selection (GS), next-generation sequencing (NGS), and gene editing (GE) tools such as the clustered regularly interspaced short palindromic repeat (CRISPR/Cas), base editing, and prime editing. These methods enable the accurate improvement of traits, thereby accelerating the development of crops resistant to both abiotic and biotic stresses. The integration of multi-omics platforms, including genomics, transcriptomics, proteomics, metabolomics, and phenomics, provides a comprehensive framework for deciphering and manipulating complex trait architectures. Artificial intelligence (AI) and machine learning (ML) enhance precision breeding by providing data-driven insights and enabling the forecasting of traits. Emphasis is also placed on combining gene editing with other strategies, such as speed breeding, to accelerate the development of traits. This review underscores the importance of an integrated systems biology approach that combines multi-omics, gene editing, AI, and speed breeding to accelerate the development of climate-resilient, high-yielding, and nutritionally enhanced crops. The integration of these innovative technologies holds great promise for addressing global food security, environmental sustainability, and agricultural resilience in the face of climate change. A strategic framework for the future of plant breeding is outlined, emphasizing the importance of interdisciplinary collaboration in building a sustainable agricultural future.