It’s Not Technically a Crime

Abstract_Burn injuries of the skin are one of the most common household injuries which vary depending on the way of induction and its severity. Common complications are sepsis of the wound and immunosuppression. A total of 44 burned patients were included in the study. Blood samples and a swab were taken from the location of burn from each patient. All cytokines (IL-5, IL-6, IL-10, G-CSF, TNF and IFN) were evaluated using the ELISA technique. Swabs were cultured and the bacterial growths were tested for sensitivity to 20 different antibiotic discs. Hematological tests were performed and compared to the healthy group control using the automated five parameter counter. The mean serum levels of the cytokines in both female and male patients were significantly higher when compared to the healthy control group. Hematological parameter level results showed an increase in WBC count in both female and male samples, eosinophil and lymphocyte levels decreased in both genders. Neutrophils have significantly increased in both female and male samples. Monocytes, basophils, and RBC count showed no significant difference in both female and male patient samples. The mean concentrations of Hb and platelets have significantly increased in males but no significant difference in female samples. In the bacteriological cultures, only 21 samples showed a bacterial growth. 14 were females and 7 were males. 7 Gram negative bacteria and 13 Gram positive bacteria were detected. 6 total bacterial species were identified (Enterococcus, Staphylococcus aureus, Staphylococcus epidermidis, Escherichia coli, Enterobacter, and Pseudomonas). Antibiotic sensitivity results showed that the number of sensitive bacteria was significantly higher than the resistant bacteria. 14 of the patients had 3rd degree burns. 5 had 2nd degree burns, and 1 had 1st degree burn. Further immunological studies are required to interpret the high mortality rates in burned patients.

SummaryGarcinia indica is an endemic fruit-yielding tree which is naturally distributed in the Western Ghats regions of India. It is also cultivated as a plantation crop. It is dioecious tree with a long vegetative phase (10 - 12 years). There are no morphological or biochemical markers to differentiate the sex of individual trees before they reach maturity. In the present study, a randomly amplified polymorphic DNA (RAPD) marker was identified, using a pooled DNA approach, which was able to identify male trees. PCR screening of bulked DNA samples from male and female trees, using 150 decamer primers, revealed one primer (OPL-05) that produced a unique band of 1,501 bp in male tree DNA samples only. OPL-05 was then used to screen individual male and female trees in different collections. The 1.5 kbp band was produced in all male samples, but was absent in all female samples. This male-specific PCR fragment was cloned and sequenced and sequence-characterised amplified region (SCAR) primers were designed from the sequence of this unique fragment.The SCAR primers produced a 1,501 bp fragment in all male tree samples, but not in any female tree DNA sample.The SCAR primers were also used to investigate the sex of unknown trees before maturity.

Background: Sex-differences in clinical presentation contribute to the phenotypic heterogeneity of hypertrophic cardiomyopathy (HCM) patients. While disease prevalence is higher in men, women present with more severe diastolic dysfunction and worse survival. Until today, little is known about the cellular differences underlying sex-differences in clinical presentation.Methods: To define sex-differences at the protein level, we performed a proteomic analysis in cardiac tissue obtained during myectomy surgery to relieve left ventricular outflow tract obstruction of age-matched female and male HCM patients harboring a sarcomere mutation (n = 13 in both groups). Furthermore, these samples were compared to 8 non-failing controls. Women presented with more severe diastolic dysfunction.Results: Out of 2099 quantified proteins, direct comparison of male, and female HCM samples revealed only 46 significantly differentially expressed proteins. Increased levels of tubulin and heat shock proteins were observed in female compared to male HCM patients. Western blot analyses confirmed higher levels of tubulin in female HCM samples. In addition, proteins involved in carbohydrate metabolism were significantly lower in female compared to male samples. Furthermore, we found lower levels of translational proteins specifically in male HCM samples. The disease-specificity of these changes were confirmed by a second analysis in which we compared female and male samples separately to non-failing control samples. Transcription factor analysis showed that sex hormone-dependent transcription factors may contribute to differential protein expression, but do not explain the majority of protein changes observed between male and female HCM samples.Conclusion: In conclusion, based on our proteomics analyses we propose that increased levels of tubulin partly underlie more severe diastolic dysfunction in women compared to men. Since heat shock proteins have cardioprotective effects, elevated levels of heat shock proteins in females may contribute to later disease onset in woman, while reduced protein turnover in men may lead to the accumulation of damaged proteins which in turn affects proper cellular function.

The study was carried out to determine the morphometric indices and parasitic incidence of 160 fresh samples of Synodontis nigrita comprising of 80 samples each of female and male sexes. Fish samples were obtained from the catches of local fishermen along Lower River Benue at Wadata fish landing site of Benue State. Length–weight relationship was analyzed using the equation W=aLb. The condition factor of the fish samples was determined using the equation, K=100W/L3. Samples of Synodontis nigrita were later subjected to parasitological examination using standard parasitological method. The mean total length, body weight, condition factor, regression and correlation coefficients were higher for un-infested female samples of Synodontis nigrita than the infested female. Similarly, the mean total length body weight, condition factor, regression and correlation coefficients of un-infested male samples of Synodontis nigrita were higher than the infested males. A total of three hundred and fifty seven (357) parasites were recovered from 76(47.50%) infested samples. Out of the 357 parasites, 251 were recovered from 49(61.3%) infested female samples, 106 parasites were recovered from 27(33.8%) infested male samples. Among the infested parts of the female samples, the intestine accounted for the highest number/percentage (116/46.4%) parasite load, the least 2(0.8%) was recorded for the skin. Between the external parts (gill and skin) of the female fish samples, while the gill recorded the higher number of parasite load 28(12.8%), skin recorded 2(0.8%). Similarly, among the infested parts of the male samples, the intestine accounted for the highest number/percentage (65/61.3%) parasite load, the least 9(8.5%) was recorded for the gill. Between the external parts (gill and skin), the gill recorded 9(8.5%) number/percentage parasite load, no parasite was recovered from the skin. Prevalence (61.25), number of parasites (251) and intensity (5.10) of parasite infection were higher for female samples compared to the male with the prevalence, and intensity of parasite infection of 33.80, 106 and 3.90, respectively. However, the chi square value showed that there was no significant difference (p>0.05) in the prevalence, number of parasites and intensity of parasite infection between the sexes of Synodontis nigrita. Variation in the prevalence and intensity of parasite infection of female and male Synodontis nigrita based on size groups existed. However, it was generally observed that longer and heavier sized fish of both sexes were more infested with higher number of parasites than the smaller sized samples of both sexes.

Acoustic properties of speech have previously been identified as possible cues to depression, and there is evidence that certain vocal parameters may be used further to objectively discriminate between depressed and suicidal speech. Studies were performed to analyze and compare the speech acoustics of separate male and female samples comprised of normal individuals and individuals carrying diagnoses of depression and high-risk, near-term suicidality. The female sample consisted of ten control subjects, 17 dysthymic patients, and 21 major depressed patients. The male sample contained 24 control subjects, 21 major depressed patients, and 22 high-risk suicidal patients. Acoustic analyses of voice fundamental frequency (Fo), amplitude modulation (AM), formants, and power distribution were performed on speech samples extracted from audio recordings collected from the sample members. Multivariate feature and discriminant analyses were performed on feature vectors representing the members of the control and disordered classes. Features derived from the formant and power spectral density measurements were found to be the best discriminators of class membership in both the male and female studies. AM features emerged as strong class discriminators of the male classes. Features describing Fo were generally ineffective discriminators in both studies. The results support theories that identify psychomotor disturbances as central elements in depression and suicidality.

We have used the impedance aggregometer to study the in vitro effect of acetylsalicylic acid (ASA) in whole blood (WB) versus platelet-rich plasma (PRP) using blood samples from 24 male and 24 female healthy volunteers. IC50 was calculated from dose-response curves of ADP-, adrenaline-, collagen- and arachidonic acid-induced aggregation. ASA inhibited platelet aggregation in WB with a lower IC50 than PRP in male and female samples; the greater differences between WB and PRP inhibitory effect of ASA were in collagen- and archidonic acid-induced aggregation. A higher ASA concentration was needed in order to produce half maximal inhibition of platelet aggregation in female than in male samples with both WB and PRP method, except when ADP was used as the aggregating agent in PRP.

Concentration of magnesium in dorsal ordinary muscles (Dom) obtained from front (Fdom) and rear (Rdom) muscle samples from wild/fattened female/male bluefin tuna (BFT) in the Turkish Eastern Mediterranean were analyzed and compared. A total of 180 individual that is (90 female and 90 male) samples were investigated. Mean Mg levels in the Fdom and Rdom samples of wild and fattened BFT were found to be as follows: 48.76 and 53.20, 52.69 and 40.29 mg 100 g-1 w wt, respectively. The mean Mg values of the Fdom and Rdom samples of 45 wild and 45 fattened individual female BFT were analyzed and found to be as follows: 51.31 and 55.09, 56.46 and 42.33 mg 100 g-1 w wt, respectively. The parameters for the Fdom and Rdom of 45 wild and 45 fattened male specimens were determined to be 46.12 and 51.40, 48.92 and 38.26 mg 100 g-1 w wt, respectively. Both wild/fattened fish, Mg differences in the Fdom and Rdom tissues and the differences in levels of Mg in the Fdom and Rdom samples of wild vs. fattened female and male samples were significant (p < 0.05). Key words: Thunnus thynnus, bluefin tuna, magnesium, muscle, front, rear, wild, fattened.

Abstract. Asrori I, Tjong DH, Novarino W, Mansyurdin, Syaifullah, Roesma DI. 2023. DNA primer design for sex identification of Sumatran tiger body samples. Biodiversitas 24: 241-249. Many reports of cases of illegal trade in animal body parts have resulted in more and more samples of animal body parts being seized. Seized sample from illegal trade needs to be identified with the help of molecular methods to ensure the profile of the seized samples including the determination of their sex. At the molecular level, amelogenin gene amplifications are used to determine the sex of mammals. Previous studies using primers for amelogenin gene amplification found that amelogenin X (AMELX) and amelogenin Y (AMELY) bands in male samples were difficult to distinguish due to very small differences, 20 base pairs (bp). The difficulty of distinguishing these bands resulted in errors in detecting male and female individual samples. Therefore, it was to design a more specific primer as a way to avoid this error. The purpose of this study was to design a DNA primer for the sex identification of the Sumatran tiger (Panthera tigris sumatrae Pocock, 1929). The research was carried out using descriptive methods and molecular observation of the AMELX and AMELY Sumatran tiger sequences. The primer design results in this study were 100% able to identify the sex of the Sumatran tiger sample. The present primer design (F= 5’ TCGGTTAACAATTCCCTGGGC’3 and R= 5’AGGCCAAATAGGAGTGTGCT’3) is more specific than the primers previously reported.

Age estimation is fundamental in forensic examinations, either in legal conditions that including living people or to identify skeletal remains. The mandible gives better growth than the other facial bones and presents morphological alterations that relate to size and remodeling during human growth. Previous studies have reported the use of facial reconstruction by three dimensional computed tomography (3D‑CT) for individual identification. The aim of this study was to investigate role of 3D CT in age estimation from mandible of a sample of Libyan Population in Tripoli. This study was conducted in National Cancer Institute, Tripoli, Libya on 200 adults for 6 months (from the beginning of January to the end of June, 2020). All subjects were subjected to 3D-CT scan to assess seven mandibular parameters which were gonial angle, ramus length, minimal ramus breadth, coronoid height, gonion-gnathion length, bicondylar breadth and bigonial length. The results showed significant positive correlation between gonial angle, gonion-gnathion length and age. While, there was significant negative correlation between ramus length, bigonial length and age either in total, male and female samples. By simple linear regression equations, age can be estimated from mandibular parameters proven to be statistically significant with highest R2 (coefficient of determination) were gonial angle and ramus length either in total, male and female samples. Additionally, there were no significant differences between actual age and estimated age by gonial angle and ramus length either in total, male and female samples. It can be concluded that age can be estimated from mandibular metric parameters measured by 3D-CT with high degree of accuracy.

The validity of the Psychopathy Checklist-Revised (PCL-R) has been examined extensively in men, but its validity for women remains understudied. Specifically, the correlates of the general construct of psychopathy and its components as assessed by PCL-R total, factor, and facet scores have yet to be examined in depth. Based on previous research conducted with male offenders, a large female inmate sample was used to examine the patterns of relations between total, factor, and facet scores on the PCL-R and various criterion variables. These variables include ratings of psychopathy based on Cleckley's criteria, symptoms of antisocial personality disorder, and measures of substance use and abuse, criminal behavior, institutional misconduct, interpersonal aggression, normal range personality, intellectual functioning, and social background variables. Results were highly consistent with past findings in male samples and provide further evidence for the construct validity of the PCL-R two-factor and four-facet models across genders.

The Level of Service Inventory‐Revised (LSI‐R) and similar correctional‐based risk and need assessment instruments, purport to be gender‐neutral. The LSI‐R was created based on research conducted on male offender samples. While there is empirical support for the gender‐neutral effectiveness of the LSI‐R and similar instruments, there is also a growing body of contemporary research that challenges this contention. Current research further outlines the potential negative implications for using so‐called gender‐neutral instruments to manage and supervise female offenders. This submission outlines salient work in this area, as well implications for the future use of risk and need instruments in community corrections.

In the present paper data on finger and palm ridge counts of both hands are reported from representative samples of healthy Bulgarian males and females. Dermatoglyphic prints from both hands of 2431 Bulgarians (1161 males and 1270 females) have been taken in 116 settlements all over the country. The investigated males and females were healthy, not related persons of Bulgarian origin. The results of finger and palm ridge counts include basic statistics and correlations between ridge counts on separate fingers and the correlations between ridge counts in separate interdigital areas. The results, presented together with data on other dermatoglyphic features elaborated and published till now by the same authors for representative samples of Bulgarian males and females, can serve for the set up of a detailed data basis of the dermatoglyphic status of the Bulgarian population. At the same time they could serve as a norm for clinical and medico-biological investigations with theoretical and scientific applied purposes.

Recent studies on PCR-based sex determination of caprine cells use amplification of a single-copy Y-chromosome-specific sequence. Our study investigated the suitability of widely used bovine sexing primers for their usefulness in sexing caprine cells. The common use of these sexing primers is to amplify BRY.4, a Y-specific sequence found in bovine cells (Reed et al. 1995 U.S. Pat# 5459038). The major advantage in amplifying these sequences is that they are multiple repeated DNA sequences. This enhances the sensitivity for use on as few as one cell. Early in their use, a problem was discovered amplifying BRY.4 for bovine sexing; one or more copies of a homologous repeat sequence were present in female cells. Copies in female cells differed by the presence of a Hinf1 restriction site. By digesting the DNA with Hinf1 either prior or subsequent to PCR amplification, it was possible to eliminate the troublesome sequence. Our study investigated whether a site homologous to theY-specific sequence was also present in female caprine cells and, if so, it too contained the Hinf1 restriction site, making possible the elimination of the troublesome sequence. The components of the PCR reaction mix were: buffer (50 mm Tris, 1% dextran T-500, 50 mm KCl, 2.5 mm MgCl2, and 0.035% 2- mercaptoethanol), deoxyribonucleotides (5 µm) (Boehringer Mannheim, Basel, Switzerland), primers (5´-GAACTTTCAAGCAGCTGAGGC-3´ and 5´-GATTGTTGATCCCACAGAAGG-3´) (2.5 µm) (custom synthesis, IDT Inc, Coralville, IA, USA), and Taq polymerase (2.7 U) (AmpliTaq DNA Polymerase, Stoeffel Fragment, Perkin Elmer, Branchburg, NJ, USA). Lymphocytes from one male and three female goat species (Saanen, Nubian/Alpine mix, and Albino) were used as the source of DNA. Approximately 100 cells/2 µL were used to ensure the amplification of the sequence homologous to theY-repeat. The DNA replication was carried out using a Corbett Rapid Thermocycler (Model FTS-IS, Corbett Research, Montlake, Australia) in 20-µL volumes, and all assays were run with positive and negative DNA controls. After replication, some samples were digested with Hinf1 (20 U) (New England Biolabs, Ipswich, MA, USA) for 2 h at 38�C. A 3% agarose gel was run in an agarose gel electrophoresis apparatus (Model 52000, IBI-Shelton Scientific, Peosta, IA, USA) for 30 min at 180 volts. All caprine species samples were run in duplicate. The DNA from three female undigested samples banded at the same position as the male samples (130 bp). The DNA from all three female digested samples banded at two positions (50 bp and 80 bp), both lower than the male samples. The male DNA remained unaltered after the Hinf1 digest, which suggests that the Hinf1 site is not present in the amplified DNA from male cells. The assay generated strong sexing bands with as few as 6 male lymphocytes, the lowest number of cells tested. These primers seem suitable if used in conjunction with Hinf1 digestion.

Sexual violence (SV) among adolescents continues to be a major public health concern with numerous consequences. Research, predominantly with male collegiate samples, has suggested an association between sports participation and SV perpetration, and has included other important risk factors such as substance use and attitudes. However, more research is needed in this area among adolescents. The current study uses latent class analysis (LCA) to examine data- driven classes of high school student athletes (N = 665) engaged in three risk factor areas for SV: sport contact level, likelihood of substance use, and attitudes dismissive of SV. Once classes were enumerated and fit separately for male and female samples, pairwise comparisons were conducted on scores on two forms of SV (perpetration of sexual harassment and unwanted sexual contact) as a function of class membership. A 5-class solution was retained for both males and females. In the female sample, regarding SV-harassment, those most likely to perpetrate sexual harassment were those characterized by high likelihood of use of cigarettes, marijuana, alcohol, vape products, and those who played any type of sport. Too few females endorsed perpetration of unwanted sexual contact for pairwise comparisons to be conducted. For males, the classes most likely to perpetrate both forms of SV were those who were likely to endorse high likelihood to use of cigarettes, marijuana, alcohol, vape products, endorse attitudes dismissive of SV, and play any type of sport but especially high contact sports. These findings implicate high school athletic spaces as important venues for sexual violence prevention efforts.

Three hundred neonatal cord blood samples were collected from two major cities in Jordan and assayed for glutathione-S-transferase (GST), glutathione, and glucose-6-phosphate dehydrogenase (G6PD). A significant positive correlation between the levels of G6PD and GST activities was detected. When the G6PD activity decreased, the GST activity declined. A similar concurrent decrease in the concentration of reduced glutathione was also observed. When the samples were divided into males and female samples, some significant variations in the levels of the two enzymes were observed. Female samples exhibited higher G6PD and GST activities as compared with male samples. Moreover, the incidence of severe and moderate G6PD deficiencies was higher in male as compared with female samples. Analyses of the samples for total bilirubin, red blood cells, hematocrit, and hemoglobin were also performed, and slight nonsignificant variations were noted.