The distribution of genus Hippobosca in Transcaucasia

Administrative evidences such as seal, seal making and seal impression are not common in the Kura-Araxes culture and considered as a rare finding why the total seals reported from Kura-Araxes sites in northwestern Iran, the southern Caucasus and Eastern Anatolia does not exceed one dozen. First and second seasons of excavation in Kul Tepe Gargar brought to light a stamp and a cylinder seals that are considered as the first evidence of seal and seal making in the Kura –Araxes culture in northwestern Iran. Between these seals, cylinder one contains special and unique design that known as the double-spiral or spiral horns in the shape of a ram’s horn or owl or human eye as a symbol of Kura-Araxes culture. As this design and symbol revealed in Kura-Araxes culture on different objects such as pottery, metal objects and other jewelry and ornaments, its appearance on the seal design proof of many changes in the economic and social organization of the Kura-Araxes culture. This seal dates back to 2900-2850 cal. BC. Since these seals are among the first evidences of administrative, economic and social ownership and property in this region of Iran, their introduction and identification can play an effective role in reconstructing the social behavior and could be considering as possible indicators of administrative control in the Kura-Araxes societies.

Documents newly found in the Historical Archives of Azerbaijan Republic reveal that as early as 1912 Ottoman agents were engaged in attempts to entice the Transcaucasian Muslims against Russia and prepare them for the war, which would break out a year-and-a-half later, namely the First World War. Ottomans encouraged the smuggling of Russian weapons and ammunition to regions bordering the Southern Caucasus, especially Northwestern Iran, counting on the sympathy of the Turkophones therein against the Russians, or on their antagonism towards the presence of Russian forces in their own territories. The heightened smuggling of Russian weapons and ammunition alarmed the Russian authorities who began looking into the cases of smugglings in an attempt to prevent or minimize them. Their findings, as expressed in their correspondences, pointed towards an extensive smuggling network headed by an Iranian émigré named Karbalāʾī who ran it with members of his own family and in collaboration with a number of Russian officials.

Stable isotope and proteomic insights into Bronze age human dietary life history at Köhne Shahar, Northwest Iran

New Light on the Earliest Hominid Occupation in East Asia

The numbers of waterfowl and shorebirds declining on a global scale is largely due to the reduction in wetland areas in the era of climate warming. Long-term monitoring data obtained in 1995–2020 in two Key Bird Areas of Russia of international importance, i.e. the Sulakskaya and Turalinskaya lagoons, the Republic of Dagestan, are presented, the transboundary populations of Anseriformes (Anatidae) taken as examples, Both model lagoons are located in one of Russia’s largest bottleneck places of the western Caspian flyways, where the fly routes of European and Asian migrants intersect. The Anseriformes model group, which includes 18 predominantly background species, was chosen based on their regular encounters during migration. According to the information on the ring returns obtained from the Research and Information Center for Bird Ringing at the Institute of Ecology and Evolution, Russian Academy of Sciences, a conditional outline of the generalized distribution range of Anseriformes was revealed, the faunogenetic basis of which is composed of widespread representatives of Arctic or Siberian fauna types. Based on all available data, including the information derived from literature sources, the geographic location both of populations and their regular migration areas was determined. The rating of 12 of all 18 study species was found to have significantly decreased, vs 2 that increased, and further 4 that remained stable. The resulting trends were synchronized with data available from literary sources on the same species of Anseriformes in their nesting areas. The coincidence of the corresponding trends with the distribution trends of the same anatid species in their nesting areas ensured the distance of distant populations of Anseriformes obtained along their flyways in the model lagoons to be correctly measured. This was found to correlate with the average monthly air temperatures in the autumn-winter period in the Primorskaya Lowland of Dagestan, 12 model species being associated with temperature fluctuations. The numbers of migratory populations of anatids in cold years are shown to lead to their increased migration in the study area, as a result the migration of migrants along the flight routes slowing down and their wintering places being changed. Correlation analysis showed a significant relation between the increased areas of Anseriformes wintering in the Caspian Sea with sea-level regression, in which the shallowing areas of marine waters limited the access of anatids to food resources (benthos). Three key factors determining the dynamics of a group of Anseriformes populations are discussed: hydroclimatic cycles, anthropogenic influence and foraging. A temporary ban on the hunting removal of 8 vulnerable species of anatids (the Greylag Goose, the Common Teal, the Garganey, the Gadwall, the Eurasian Wigeon, the Northern Pintail, the Northern Shoveler, and the Common Pochard) is proposed to be imposed in Siberia, Kazakhstan, the Urals Federal District, the Cis-Urals, the Volga region, and the Southern and North Caucasus federal districts until their populations become sufficiently restored.

The article provides information about professional activity of Mariya Ivanovna Dergacheva, a remarkable scientist and pedagogue, Doctor of Biological Sciences, Professor, member of the Russian Academy of Natural Sciences and an honoured scientist of the Russian Federation. Working very productively in the Institute of Soil Science and Agrochemistry of the Russian (formerly the USSR) Academy of Sciences, Prof. Dergacheva devoted more than 50 years to studies in soil science and ecology, becoming one of the leading specialists in research on formation and functioning of the system of humus substances and their role in biospheric processes. As a talented pedagogue, Prof. M.I. Dergacheva organized the first International School for young scientists in paleopedology.

The reform of the Russian Academy of Sciences (RAS), creation of the Federal Agency of Scientific Organizations (FANO), a change in legislation, the integration of three academies: Academy of Sciences, the Russian Academy of medical Sciences (RAMS), Russian Academy of agricultural Sciences (RAAS); restructuring of research institutions - served as prerequisites for changing RAS library system and called for the regulation of interaction and relationships between libraries within the system of scientific organizations. In these new conditions, a new concept of library and information support of scientific research is required to identify mechanisms for the uniform distribution and optimal development of libraries under FANO jurisdiction.

(Guldens-taedt, 1770) remains the least studied member of thefamily Mustelidae. Our previous molecular geneticanalysis [1] provided more specific information on phy-logenetic relationships of the genus; however, theintraspecific structure of the marbled polecat is stillunknown, although the species area is rather extendedand covers the entire steppe, desert, and semidesertzones of Eurasia. Sequencing the mitochondrial DNAof marbled polecats from southern Russia, Transcauca-sia, Turkmenistan, and Uzbekistan showed a highdegree of the species genetic homogeneity in a largepart of the area, and no distinctions were found betweenanimals from the above regions, though some of thesepopulations are now assumed to be valid subspecies.Among numerous marbled polecat forms that weredescribed at different times, the following ones are nowvalid: V. p. peregusna, V. p. syriaca, V. p. pallidior,V. p. euxina, V. p. koshevnikovi, and V. p. negans [2].The taxonomy of marbled polecats from some regions(Kyzyl Kum, Transcaucasia, Tadjikistan, etc.) remainsunknown.The following samples were the objects of ourstudy. Southern Russia: VP1_KLM ([1]: VP1),Kalmykia, 2002; VP2_RST ([1]: VP2), Rostov oblast,1999. Transcaucasia: VP5-2_ARM, Armenia, nearLake Sevan, 2005 (muscles preserved in alcohol); VP5-3_AZR, Azerbaijan, Lachin outskirts, the ZabukhRiver, 1999 (a dry skin). Turkmenistan: VP4-4_TRK(the collection of the Zoological Institute (ZIN) of theRussian Academy of Sciences: C.51339), VP4-5_TRK(ZIN: C.51340), and VP4-7_TRK (ZIN: C.51403); allthe three samples were from southeastern Kara Kum,1964; VP4-6_TRK (ZIN: C.40194), Kushka outskirts,1956; VP4-8_TRK (ZIN: C.48161), Mary outskirts,1960; The material from ZIN consisted of ZIN collec-tion fingers on dry skins. Uzbekistan (Kysyl Kum):VP3-2_UZB ([1]: VP3), 1991, VP3-7_UZB, 1993,both samples were from Bukhara oblast, 25 km south-east of Bukhara, dry skins.For all 11 samples, the left domain sequences of themtDNA control region were determined (253–256 bp,256 positions); for samples VP5-3_AZR, VP4-6_TRK,and VP3-2_UZB, the complete sequences of the cyto-chrome b gene (1140 bp) were determined; for the sam-ples VP1_KLM, VP2_RST, VP5-2_ARM, VP4-4_TRK, and VP4-7_TRK, the complete sequences ofboth cytochrome b gene and the mtDNA control region(1085–1108 bp, 1109 positions) were determined.DNA was extracted as described previously [1]. Forthe cytochrome b gene amplification, internal primersCVS-r2 (cgggtttaatatggggtggt) and CVS-f2 (atattccca-gaaacatgaaacatc) were designed as pairs to the previ-ously used CVS-f1 and CVS-r1 primers [1]. For ampli-fication of the control region, we developed pairs ofprimers DVS-f1 (cctccctaagactcaaggaagaa)–DVS-r2(tgtcctgtgaccattgactga) and DVS-f2 (aatcagcccatgatca-caca )– DVS - r 1 ( ggctaggaccaaacctttatg ). The PCR pro-file was were the following: I, 94 ° C for 3 min; II, 94 ° Cfor 45 s, 54 ° C for 1.5 min, and 70 ° C for 2 min(30 cycles); III, 70 ° C for 3 min. For some samples withunstable DNA, primer DVS-r3 (ttatgtgtgatcatgggctga)or DVS-r4 (ccagatgccaggtatagtttca) was used togetherwith the DVS-f1 primer to amplificate the left domainof the control region. All primers were constructedusing the Primer3 software [3].Both both strands of each mtDNA region were rec-ognized for each region of every sample (an ABIPRISM 310 analyzer; BigDye Terminator v.3.1reagents as described in [1]). The sequences werematched using the BioEdit v.7.0.1 software [4]. Thecontrol region borders were determined by alignment

Journal of Applied Polymer ScienceVolume 77, Issue 13 p. 3024-3026 Note IR spectroscopic study of fibers made of polypropylene with grafted copolymer of styrene and divinyl benzene A. A. Shunkevich, A. A. Shunkevich Institute of Physical Organic Chemistry, Belarus Academy of Sciences, 220072 Minsk, Surganova 13, BelarusSearch for more papers by this authorV. S. Soldatov, V. S. Soldatov Institute of Physical Organic Chemistry, Belarus Academy of Sciences, 220072 Minsk, Surganova 13, Belarus Technical University of Lublin, 20-618, Lublin, PolandSearch for more papers by this authorO. P. Popova, O. P. Popova Institute of Physical Organic Chemistry, Belarus Academy of Sciences, 220072 Minsk, Surganova 13, BelarusSearch for more papers by this authorKatherine Kober, Corresponding Author Katherine Kober Fracture Physics Department, Ioffe Physico-Technical Institute, Russian Academy of Sciences, 194021 St. Petersburg, RussiaFracture Physics Department, Ioffe Physico-Technical Institute, Russian Academy of Sciences, 194021 St. Petersburg, Russia===Search for more papers by this authorA. Tshmel, A. Tshmel Fracture Physics Department, Ioffe Physico-Technical Institute, Russian Academy of Sciences, 194021 St. Petersburg, RussiaSearch for more papers by this author A. A. Shunkevich, A. A. Shunkevich Institute of Physical Organic Chemistry, Belarus Academy of Sciences, 220072 Minsk, Surganova 13, BelarusSearch for more papers by this authorV. S. Soldatov, V. S. Soldatov Institute of Physical Organic Chemistry, Belarus Academy of Sciences, 220072 Minsk, Surganova 13, Belarus Technical University of Lublin, 20-618, Lublin, PolandSearch for more papers by this authorO. P. Popova, O. P. Popova Institute of Physical Organic Chemistry, Belarus Academy of Sciences, 220072 Minsk, Surganova 13, BelarusSearch for more papers by this authorKatherine Kober, Corresponding Author Katherine Kober Fracture Physics Department, Ioffe Physico-Technical Institute, Russian Academy of Sciences, 194021 St. Petersburg, RussiaFracture Physics Department, Ioffe Physico-Technical Institute, Russian Academy of Sciences, 194021 St. Petersburg, Russia===Search for more papers by this authorA. Tshmel, A. Tshmel Fracture Physics Department, Ioffe Physico-Technical Institute, Russian Academy of Sciences, 194021 St. Petersburg, RussiaSearch for more papers by this author First published: 19 July 2000 https://doi.org/10.1002/1097-4628(20000923)77:13<3024::AID-APP29>3.0.CO;2-RRead the full textAboutPDF ToolsRequest permissionExport citationAdd to favoritesTrack citation ShareShare Give accessShare full text accessShare full-text accessPlease review our Terms and Conditions of Use and check box below to share full-text version of article.I have read and accept the Wiley Online Library Terms and Conditions of UseShareable LinkUse the link below to share a full-text version of this article with your friends and colleagues. Learn more.Copy URL Share a linkShare onFacebookTwitterLinked InRedditWechat Volume77, Issue1323 September 2000Pages 3024-3026 RelatedInformation

Based on archive documents, this article gives a biography of Emilia Fedorovna Miram (1868–1942), the first head of the section of the orthopteroid insects at the Zoological Institute (formerly the Zoological Museum) of the Russian Academy of Sciences. It describes her contribution to the largest collection of orthopteroids in Northern Eurasia and her role within the St. Petersburg (Leningrad) community of entomologists. Emilia Miram began working at the Zoological Museum in 1896. Between 1906 and 1917, members of the Russian Entomological Society could purchase almost any entomological equipment and supplies with her assistance. Between 1920 and 1942, she curated the orthopteroid collection and made a huge contribution to its growth and organization. For nearly thirty years, she headed a special entomological preparation department, in which all insect collections acquired by the Zoological Institute were subjected to initial treatment. Over the years, she trained at least two hundred people in the preparation, mounting, storage and registration of entomological collections. Emilia Miram also worked at the entomological office of the Main Directorate of Аppanages (1912–1917), at the Lakhta Excursion Station (1919–1928) and in the Department of Applied Entomology (1922–1924). The Supplement includes a list of Emilia Miram’s publications, a list of taxa named after her and those she described, reviews of her work, and some other documents.

Type specimens of 67 taxa of Phasmida (including probable type specimens of 24 taxa) have been located in the Zoological Institute, Russian Academy of Sciences, St. Petersburg. The species are listed alphabetically, with the number of specimens, sex and locality data.

Russian Science and Technology policy is formally regulated by the same bureaucratic organizations as in the former USSR. The Russian Academy of Sciences, as successor to the USSR Academy of Sciences, is responsible for the organization of fundamental research. The Ministry of Science and Technical Policy of the Russian Federation (successor to the USSR State Committee of Science and Technology) determines the subject and budget of the State R&D Program and selects scientific research institutions (mostly industry oriented) for the role of State Scientific Center. In reality, however, the state science and technology policy in Russia is totally different from that of the former USSR.

The history of ethology in Berlin

The Academy of Science of South Africa (ASSAf) and the Department of Science and Innovation (DSI) jointly hosted the 2023 BRICS Academies Forum on 1-2 December 2023 in Pretoria, South Africa. The Forum is the body of science academies of the BRICS member states including the: Brazilian Academy of Sciences (ABC), Russian Academy of Sciences (RAS), Indian National Science Academy (INSA), Chinese Academy of Sciences (CAS), and ASSAf. The theme of the 2023 BRICS Academies Forum Meeting was “Inter-Academy Collaboration on Global Crises” which was aligned to the 2023 BRICS Science, Technology, and Innovation (STI) theme; “Building BRICS and Africa Partnership for Mutually Accelerated Growth, Sustainable Development and Inclusive Multilateralism.” The delegations of the BRICS Academies were welcomed by ASSAf Acting President, Prof Stephanie Burton, and DSI Deputy Director-General for International Cooperation and Resources, Mr Daan du Toit during the Opening and Welcome Dinner ceremony on the 1st of December. Day 2 of the meeting was dedicated to technical presentations by each Academy and subsequent discussions. Prof Burton directed the proceedings and Prof Himla Soodyall the ASSAf Executive Officer moderated the discussion.

International Laboratory of High Magnetic Fields and Low Temperatures, Wroclaw, Poland is financed by the Bulgarian Academy of Sciences, National Academy of Sciences of Ukraine, Polish Academy of Sciences and Russian Academy of Sciences as the main contributors. But the scientists from Germany, UK and other countries are also users of the Laboratory facilities. The Laboratory offers the measurements of the magnetic, transport and some optical properties, and magnetostriction both in permanent magnetic fields (Bitter and superconducting coils) up to 20 T, and in quasi-pulsed magnetic field up to 55 T with pulse duration of about 0.1 s in the temperature range 0.7–300 K.