J. Craig Venter Institute

The SARS-CoV-2 pandemic has highlighted the need for society, as a whole, to be prepared against potential pandemics caused by a variety of different viral families of concern. Here, we describe a roadmap towards the identification and validation of conserved T cell epitope regions from Viral Families of Pandemic Potential (VFPP). For each viral family, we select a prototype virus, the sequence of which could be utilized in epitope identification screens. Examples of viral families considered and their respective prototypes (species/ subspecies) are Coronaviridae (Severe Acute Respiratory Syndrome-related Coronavirus/ SARS-CoV-2), Flaviviridae (Dengue virus/DENV2), Togaviridae (Chikungunya virus/ CHIKV), Paramyixoviridae (Morbillivirus/measles), Arenaviridae (Mammarenavirus/ Lassa), and Picornaviridae (Enterovirus C/poliovirus). The peptide sequences encoded in each prototype virus are then analyzed to determine their conservation across different viral taxonomic groups and viral variants derived from each of the VFPP. We outline available methodologies for epitope discovery based on panels of overlapping peptides and bioinformatics- based predictions of HLA-peptide binding, along with high-throughput in vitro assays, with emphasis on addressing coverage of the general worldwide population. Validation can be achieved by a variety of methodologies, including determining HLA restriction and recognition in samples from volunteers convalescent from previous infections or immunized with approved or experimental vaccines, and immunophenotyping of responding T cells. The capacity of these regions to induce crossreactive T cell responses can be tested experimentally with homologous peptides derived from the various viral species of interest. Importantly, they could be considered as a component of pan-viral family vaccines. Conversely, immunogenic regions that are highly specific to a given virus could be of interest for diagnostic applications.

Bioinformatic analysis of Enterococcus faecalis temperate phage ϕEf11 identified prospective attP and attB core attachment (att) sites consisting of identical 27 nt sequences (ACTAAGCAAGTGCCGCCATGTGTCTGA). The presumptive attPcore site was located 74 nts from the terminus of the ϕEf11 integrase (ORF 31) while the presumptive attB site was located within ffs, encoding the 4.5S RNA component of the signal recognition particle (SRP). After examining 6,028 genomes of 61 Enterococcal species using updated Phage_Finder software, attL and attR sequences disrupting ffs could only be detected in lysogenic strains of E. faecalis. We have found no other example of a prophage inserted into ffs, therefore, the ffs locus for ϕEf11 integration represents a novel phage attachment site. SRP functions in the transport of proteins through the cellular membrane to the periplasmic space. Integration into ffs resulted in alteration of the 3’ end of the 4.5 S RNA, where in E. coli, alterations in the same region cause defects in membrane protein insertion. Lysogens of ϕEf11 are resistant to the ϕEf11 endolysin. Since endolysin activity is dependent upon binding to cell surface receptors, it is conceivable that defective SRP function results in alteration of the endolysin receptor, preventing endolysin function.Supplementary InformationThe online version contains supplementary material available at 10.1038/s41598-025-20531-7.

Background/Objectives: Biofilm formation by Acinetobacter baumannii contributes to its persistence in clinical settings and resistance to antibiotic treatment. This study aims to identify and characterize antimicrobials from lactic acid bacteria (LAB) using molecular and in silico approaches that can prevent and disrupt A. baumannii biofilms, assess their antimicrobial host range, and define their synergy with current antibiotics. Methods: Thirteen LAB isolates from the Human Microbiome Project were screened for anti-biofilm activity against A. baumannii. Conditioned media was further tested against six ESKAPE pathogens and three skin commensals. Lentilactobacillus hilgardii was selected for detailed study and antimicrobial peptide (AMP) prediction analysis due to limited toxicity toward commensals. In silico identified peptides were synthesized and tested individually and in combination with sub-MIC doses of an antibiotic. Results: Conditioned media from five LAB species (Lentilactobacillus hilgardii, Lentilactobacillus buchneri, Ligilactobacillus ruminis, Limosilactobacillus fermentum, and Limosilactobacillus antri) significantly inhibited A. baumannii biofilm formation and reduced biomass of mature biofilms. LAB-conditioned media also exhibited broad-spectrum activity against ESKAPE pathogens, though effects on commensals varied. Bioinformatically predicted AMPs from L. hilgardii inhibited planktonic A. baumannii growth but showed no direct biofilm activity even at high doses. However, AMPs were found to synergize with sub-MIC doses of meropenem against mature biofilms leading to decolonization. Conclusions: Our study provides a comprehensive platform for the discovery and characterization of AMPs and supports using commensal bacteria to reduce, prevent, and decolonize biofilms from pathogenic bacteria in community and nosocomial settings.

BackgroundMultimorbidities are a global health challenge. Accumulating evidence indicates that overlapping genetic architectures underlie comorbid complex human traits and disorders. This can be quantified for a pair of phenotypes using various techniques. Still, the pattern of genetic overlap between three distinct complex phenotypes, which is important for understanding multimorbidities, has not been possible to quantify.MethodsHere, we present and validate the novel trivariate MiXeR tool, which disentangles the pattern of genetic overlap between three complex phenotypes using summary statistics from genome-wide association studies. Our simulations show that trivariate MiXeR can reliably reconstruct different patterns of genetic overlap and estimate the proportions of genetic overlap between three phenotypes.ResultsWe found substantial genetic overlap between gastro-intestinal and brain diseases supporting a genetic basis of the gut-brain axis—the pattern consistent with pairwise analysis. However, the pattern of genetic overlap between three diverse cardiometabolic and renal health indicators and three immune-linked disorders revealed a much larger genomic component shared between all phenotypes than expected from separate pairwise analyses. This suggests the existence of core pathways underlying distinct but related chronic conditions.ConclusionsOverall, trivariate MiXeR offers a novel and efficient tool for investigating patterns of genetic overlap among three complex phenotypes. This contributes to a better understanding of genetic relationships between complex traits and disorders, potentially providing new insights into the mechanisms underlying common multimorbidities. Trivariate MiXeR is freely available at https://github.com/precimed/mix3r.Supplementary InformationThe online version contains supplementary material available at 10.1186/s13073-025-01528-3.

Objective:To determine correspondence between self-reported substance use and biochemical verification through hair samples and to estimate U.S. prevalence of adolescent substance use.Methods:Data came from the nationwide Adolescent Brain Cognitive Development Study (n=11,868; age 9-10 at Baseline, age 15-16 at Wave 6). Past-3-month substance use was measured annually from 2016 to 2024. Hair samples objectively detected moderate+ substance use in a subsample of participants (nsamples=11,865; n=6,133 unique participants). Multi-step weighting methods estimated national prevalence trends of cannabis, alcohol, and nicotine use over time, adjusting for discrepancies in sample representation due to recruitment demography, missed visits, and hair samples testing.Results:Correspondence between self-report and toxicological data improved with age (ages 11-12=<1%; ages 15-16=45%). Weighted estimates of biochemically verified substance use indicated 7.1% of 15-16 year olds engaged in moderate-to-heavy cannabis use, 0.3% heavily used alcohol, and 4.7% heavily used nicotine.Conclusions:Youth reported substance use patterns demonstrated improved biochemical verification with age. Biochemical verification reflects substantive cannabis and nicotine use by ages 15-16, supporting combining toxicological and self-report data to improve identification of substance use in youth.

ABSTRACT Phytoplankton community composition during austral summer 2022 in the Argo Abyssal Plain (Argo Basin), a 5000-m deep area northwest of the Australian continent in the eastern Indian Ocean, is described in detail, including phytoplankton abundance, biomass, size structure, taxonomic identifications through DNA and pigment analyses, as well as the percent of functional mixotrophs. The region was characterized by warm (up to 30.5°C), stratified, oligotrophic (nitrogen-limited) waters, with integrated euphotic zone (EZ) chlorophyll a (CHL a ) of 13 mg m -2 . The EZ mean CHL a was low in the upper layer (0.085 µg L -1 ) and 0.32 µg L -1 at the pronounced deep CHL a maxima. EZ-integrated phytoplankton carbon averaged 1229 mg C m -2 . Prochlorococcus was the dominant taxon throughout the EZ, but the lower EZ had ∼4-times more eukaryotic carbon biomass than the upper EZ, along with a distinct community. In the upper EZ, prymnesiophytes, dinoflagellates and prasinophyte taxa without prasinoxanthin had the highest contributions to monovinyl chlorophyll a (MV-CHL a ). In the lower EZ the community was more diverse, with prymnesiophytes, dinoflagellates, prasinophyte taxa with prasinoxanthin, pelagophytes, and cryptophytes all comprising significant contributions to MV-CHL a . Diatoms were a minor part of the community. In the upper EZ, a higher percent of the community showed mixotrophy (35-84%) relative to the lower EZ (30-51%). Although a low abundance, nitrogen-fixing organisms (symbionts of diatoms and cyanobacteria taxa) were ubiquitous. Overall, the community was similar to that found at the Hawaii Ocean Time-series site and the central Gulf of Mexico.

Severe mental disorders have been linked to immune system dysfunction. While a genetic association between mental disorders and autoimmune diseases has been suggested, their genetic relationship remains incompletely understood. Utilizing a complementary set of statistical analyses, we conducted a comprehensive investigation of the genetic architecture between severe mental disorders (major depression (MD), bipolar disorder (BD), and schizophrenia (SCZ)) and seven autoimmune diseases (autoimmune thyroiditis, celiac disease, inflammatory bowel disease (IBD), multiple sclerosis, psoriasis, rheumatoid arthritis, and type 1 diabetes), involving a total of 667,518 cases from 10 genome-wide association studies. While MD was positively genetically correlated with five autoimmune diseases, BD and SCZ were only positively correlated with IBD, suggesting differences in the genetic signal shared with autoimmunity across these mental disorders. A considerable fraction of genetic variants influencing autoimmune diseases (range 17.1-88.4 %) were estimated to overlap with mental disorders; however, this constitutes only a minor part of genetic variants influencing the more polygenic mental disorders. Finally, we identified 172 genetic loci jointly affecting mental disorders and autoimmune diseases, implicating both lipid metabolism and TNF signaling. In conclusion, MD, BD, and SCZ have a small but distinct genetic overlap with autoimmune diseases, which may inform new possible immune targets for treatment in mental illness.

The annual Minimal Cell Workshop, hosted by the J. Craig Venter Institute (JCVI), is an international virtual seminar that brings together over 80 academic, industrial, and government laboratories. Researchers use the JCVI's minimal bacterial cell platform to explore the principles of cellular life and integrate new chemical pathways. Since its creation in 2016, this platform has fostered global collaborations. The fourth workshop featured 26 talks on ongoing research with minimal cell strains, including JCVI-syn1.0, JCVI-syn3.0, JCVI-syn3A, and JCVI-syn3B. Topics included innovative imaging techniques like super-resolution microscopy and cryotomography, DNA replication assays, and minimal cell division. New approaches for ATP synthesis and the role of moonlighting proteins were also discussed. JCVI-syn3B applications explored its potential in understanding persistent pathogens and as an anticancer therapeutic. The workshop encouraged sharing techniques for cell culture and genetic manipulation, fostering collaboration and advancing efforts to develop genome-scale algorithms for understanding and manipulating cellular functions.